Other articles:
|
Suggested searches related to 'repeatscout'. . search google for repeatscout · repeatscout, 6030, repeatscout · search google for repeatscout software .
INTRODUCTION ============ This directory contains source code related to .
Aug 14, 2006 – RepeatScout is a denovo repeat finder created by the Pevzner lab at . Retrieved from "http://genomewiki.ucsc.edu/index.php/RepeatScout" .
>Unknown#DNA transposon ( RepeatScout Family Size = 298 Final Multiple . AGTC >rnd-1_family-148agk2#Unknown ( RepeatScout Family Size = 111 Final Multiple .
Nov 24, 2010 – Exercise 1: Repeat identification using RepeatMasker, RepeatScout, TRF Exercise 2: Improve structural annotation by comparing conflicting .
Jun 19, 2005 – RepeatScout is a tool to discover repetitive substrings in DNA. The RepeatScout source code can be downloaded from the links bellow: .
Your browser may not have a PDF reader available. Google recommends visiting our text version of this document.
by D Depledge - 2007 - Cited by 15 - Related articles
>Unknown#DNA transposon ( RepeatScout Family Size = 262 Final Multiple . . TGGTCCATT >rnd-1_family-140agk1#Unknown ( RepeatScout Family Size = 112 Final .
File Format: Microsoft Word
Jan 31, 2006 – TwoYforksconnectedcomponenthumanRepeatScoutlibraryrepeatdomaingraph gb-2006-7-1- r7-7.jpg admin 2011/07/23 Yes .
(3) Filtered RepeatScout library. . The goal is to avoid the filtration of any repeat from the RepeatScout library based on those gene models that could be TE. .
File Format: PDF/Adobe Acrobat - Quick View
RepeatScout: the main idea TAGCACCTTAGGGCGTCTCGCAACGTCTGCCCACGAACGTTAATCAGTAA GATTATCATGAAGCGCTTCGCAACGTCTGCAGCTGTCCAGACCGCTGTCA .
3 posts - 2 authors - Last post: May 6Can I run more than one RepeatScout at one time. Running one repeatscout .
File Format: PDF/Adobe Acrobat - Quick View
INTRODUCTION ============ This directory contains source code related to RepeatScout, which is described in detail in the following paper: Price A.L., .
File Format: PDF/Adobe Acrobat - Quick View
by AL Price - 2005 - Cited by 121 - Related articles
File Format: PDF/Adobe Acrobat - Quick View
Every Where We Go ( Scoutz Repeat ) People Always Ask Us ( Scouts Repeat ) Who We Are ( Scoutz Repeat ) And Where Do We Come From ( Scouts Repeat .
by C Feschotte - 2009 - Cited by 14 - Related articles
File Format: PDF/Adobe Acrobat - Quick View
by S Saha - 2008 - Cited by 24 - Related articles
Nov 18, 2008 – Recent papers added to treangen's library classified by the .
Jump to RepeatScout: RepeatScout. command line only, requires compilation. Site: http://bix.ucsd.edu/ repeatscout/. current version (2010-03): 1.05 .
Mar 26, 2008 – This satellite was identified in the RepeatScout library and . RepeatScout identified 31 highly repetitive DNA elements with repeat units .
We have also updated the RepeatScout release ( RepeatScout-1.0.5 ) with a bugfix to the . RepeatMasker, RepeatMasker Libraries, and RepeatScout Updates .
The purpose of the RepeatScout software is to identify repeat family sequences from genomes where hand-curated repeat databases (a la RepBase update) are .
4 posts - 3 authors - Last post: Aug 9, 2010RepeatMasker & RepeatScout Bioinformatics. . Basically I have a new genome, and want to use RepeatScout to make a library for .
RepeatModeler assists in automating the runs of RECON and RepeatScout . RepeatScout - De Novo Repeat Finder, Price A.L., Jones N.C. and Pevzner P.A. .
RepeatScout 15-Jun-2011 15:40 43k [ ] build_lmer_table 15-Jun-2011 15:40 18k [ ] build_lmer_table.c 03-Jun-2008 15:07 13k [ ] build_lmer_table.h 08-Feb-2008 .
Apr 4, 2008 – [Rmannounce] RepeatScout On Multiple Sequences. Robert Hubley rhubley at systemsbiology.org. Tue Apr 1 14:02:03 PDT 2008. Next message: .
Index of /afs/plant_science/psgendb/local/pkg/RepeatScout-1. Name Last modified Size Description · [DIR] Parent Directory 25-Aug-2011 14:07 - [ ] .
Jun 16, 2005 – repeatscout-ismb. Author: N/A. Company: N/A. Description: . alu | repeat | famili | repeatscout | consensus | idea | sequenc | mer .
Jan 17, 2011 – Recent papers added to sannenygaard's library classified by the tag repeatscout. You can also see everyone's repeatscout. .
File Format: PDF/Adobe Acrobat - Quick View
repeatscout.bioprojects.org is a domain maintained by 2 domain name servers ns2. ucsd.edu, ns1.ucsd.edu. Domain name is registered under org top level domain .
3 posts - 2 authors - Last post: May 14Try running REPCLASS or TEclass on the output of RepeatScout (or RECON) for classification of putative TEs. REPCLASS uses both .
File Format: PDF/Adobe Acrobat - View as HTML
Jan 9, 2011 – RepeatScout was run on individual chromosomes and its output converted to make it compatible with PILER output. To identify redundancy .
by S Wang - 2008 - Cited by 9 - Related articles
Going on a lion hunt! But I'm not afraid! Cause I got my guns! And my bullets at my side! (add on and repeat endtire thing) 1. Swimming across the River 2.
120+ items – Hadi Quesneville and I wrote a review article .
File Format: Microsoft Powerpoint - Quick View
File Format: Microsoft Word - Quick View
File Format: Microsoft Powerpoint - Quick View
>rnd-1_family-8pyth#Unknown ( RepeatScout Family Size = 222 Final Multiple . > Unknown#DNA transposon ( RepeatScout Family Size = 140 Final Multiple .
We ran RepeatScout on human, mouse and rat X chromosomes. We filtered out . or the RepeatScout library as input, and compared the results: .
>rnd-1_family-17#Unknown ( RepeatScout Family Size = 295 Final Multiple . > rnd-1_family-10#Unknown ( RepeatScout Family Size = 405 Final Multiple .
Sitemap
|