hi all, howto split string with both comma and semicolon delimiters? i.e. (for

Apr 13, 2009 . I want my python function to split a sentence (input) and store each word in a list.

Python String split() Function - A beginner's tutorial containing complete

print ss ['word1', 'word2'] Some examples to show that this is not the same as

Python provides a rich API to help you to process string effectively. It supports

Jan 12, 2009 . Split string into different variables instead of array in Python. Related. Is there a

Oct 12, 2005 . Split string on capitalized/uppercase char (Python recipe) by Graeme Glass.

Mar 6, 2012 . If you want to analyse for example apache log files and split the lines by space by

Second Part of our Introduction into Regular Expression under Python. . Splitting

You have a list of key-value pairs in the form key=value, and you want to join

[Tutor] Split a string into characters. Hans Dushanthakumar Hans.

It is very easy to split a line of text using Python into an array of words. . an array

Article in the Python forum by -obol-. DaniWeb IT Discussion Community: Where

Feb 23, 2012 . In addition, Python's built-in string classes support the sequence type . . The

Mar 14, 2012 . Everyone has plenty of basic doubts when starting with a new language, but did

Jan 26, 2009 . Split and join in python are similar to the equivalent functions in most . 'cat', 'sat', '

Apr 17, 2010 . This entry was posted in python, technology and tagged parse, python, split,

split and join - Python example. . String Handling example from a Well House

Jul 29, 2011 . string split method and examples in Python So you are looking to break up a

indicate input to Python (these are the default prompts of the interactive

Feb 8, 2010 . How to split a string in half in python? I also want the 2 halves to be new strings.

String Split « String « Python. . A sentence is split up into a list of words · A

Oct 26, 2003 . With string.split() you the token you split on isn't included in the . splitter.split('hi<

Feb 14, 2011 . I'm trying to split a string using a regular expression. Friday 1Friday 11 JAN 11.

Jan 17, 2011 . Hi, I need some help splitting a string by every nth characters. I'm using Python

Feb 23, 2012 . Split the string at the first occurrence of sep, and return a 3-tuple containing the

Mar 7, 2012 . Python has a function called ord() (short for ordinal) that returns a character as a

. separators. Get Python help and support on Bytes Support Forums. . OK, so I

Sep 15, 2011 . HowTo: Split Python strings with multiple separators. Python strings split with

Dec 27, 2010 . I have an enormous string and would like to split the string: Example:

split and join : String join « String « Python. . You can normalize whitespace by

I'm trying to figure this out, but every google I do just brings up garbage. What I'm

Article in the Python forum by kes_ee. DaniWeb IT Discussion Community:

Python String splitlines() Function - A beginner's tutorial containing complete

Mar 20, 2011 . Split Strings w/ Multiple Separators (Python recipe) by Kenneth Reitz. ActiveState

Ok, I'm new to python and in programming in general as well. I'm writing a python

Jul 29, 2003 . See the module re for string functions based on regular expressions. . The string

Jun 29, 2009 . But python's split() only works with one argument. so I have all words with

Oct 28, 2010 . I have this string: 'ACC': 2, 'ACACAGTTTGCGCGCGCGGGG': 1, 'ACCGTA': 3, '

Mar 20, 2011 . Description: Split Strings w/ Multiple Separators (Python). Public Clone URL: git://

Feb 3, 2010 . Python — Split String in Half. Here is an easy way to split a string in two. I just

Python programs do not have a required first or last line, but can be given the . .

Aug 2, 2011 . My Personal Style Guide for Python Source Code. The Wing . Long strings can

Jun 6, 2006 . Split String into n-size pieces (Python recipe) by Matt Wallace. ActiveState Code (

Mar 16, 2012 . split strings on multiple seperators: . Multiple Choice Questions In Python -

Feb 21, 2008 . Split the string at the first occurrence of sep , and return a 3-tuple containing the

May 2, 2005 . Programmers need to know how to manipulate strings for a variety of purposes,

File: string-example-1.py import string text = "Monty Python's Flying Circus" print "

String methods are the first line of text-processing tools in Python. Other methods

Sep 5, 2011 . Home » python reference » Python String Methods . .. splitlines([keepends]):

Sitemap